Studies of the Major Gene Expression and Related Metabolites in Cannabinoids Biosynthesis Pathway Influenced by Ascorbic Acid

Abstract

Cannabis sativa L. is an annual dioecious plant that belongs to the Cannabaceae family and is essential for different pharmaceutical and nutritional properties. The most important and prevalent cannabinoids in cannabis are cannabidiol and delta-9-tetrahydrocannabinol. The application of elicitors is an effective method to improve secondary metabolite production, leading to a whole spectrum of molecular, genetic, and physiological modifications. Therefore, the expression changes of four key genes (THCAS, CBDAS, PT, and OLS) of the cannabinoids pathway along with the delta-9-tetrahydrocannabinol and cannabidiol metabolites fluctuation were surveyed following the application of ascorbic acid as an elicitor. Cannabis was sprayed immediately before flowering with ascorbic acid. Treated and untreated (control) plants were sampled in different time courses for real-time PCR and HPLC experiments. Results showed significant increases in THCAS, CBDAS, PT, and OLS expression after ascorbic acid treatments. The results of metabolite quantification also indicated that secondary metabolites, especially delta-9-tetrahydrocannabinol and cannabidiol, increased after the ascorbic acid application. This study contributes to the growing body of knowledge of the functions of key genes in the cannabinoids pathway to the engineering of cannabis for improving the production of delta-9-tetrahydrocannabinol and cannabidiol metabolites in this plant.

Key words

Cannabis sativa - Cannabaceae - ascorbic acid - cannabidiol - delta-9-tetrahydrocannabinol - gene expression - metabolites

Introduction

Cannabis sativa L. is a source of food, fiber, and drugs in Asia and Europe. Cannabis is a native plant of countries in Central, South East, and Western Asia as well as Eurasian countries, including Russia, and in China, India, Pakistan, and Iran. In particular, cannabis is a native plant of the Indian Himalayan Region and this plant grows abundantly in nonarable lands [1]. Medicinal plants such as cannabis have been used as an important pharmaceutical source. In the past, cannabis (Cannabaceae, hemp, marijuana) was consumed as a psychoactive herbal and medicinal drug [2] [3], but currently, among illegal drugs, it has the highest consumption around the world [4]. There are growing activities to legalize marijuana because of its medicinal advantages [5]. So far, more than 545 different compounds such as CBDA and THCA have been isolated and identified from cannabis. Despite intoxication effects, THCA and CBDA compounds in marijuana show various therapeutic activities such as neuroprotective effects, analgesia, antipyretic, and appetite stimulation in AIDS patients, and is used in the treatment of multiple sclerosis, Parkinson’s disease, and various cancers [6] [7] [8] [9].

MEP and hexanoate pathways are the two possible pathways that have been proposed for the biosynthesis of cannabinoids using isoprenoid precursors and fatty acids ([Fig. 1]). The first pathway is conducted by olivetolic acid synthase that catalyzes the hexanoyl-CoA condensation using three malonyl-CoA molecules to generate OA [10] [11] [12]. Next, GPP pentylates olivetolic acid [13] [14]. Decarboxylation is the last step in the first pathway [15]. The second pathway is hexanoyl-CoA biosynthesis, and the substrate in this pathway is hexanoate [16]. In the next step, OAC and TKS/OLS coordinatedly catalyze the conversion of hexanoyl-CoA into olivetolate [17]. Gene expression encoding CsTKS and CsOAC produces OA, prenylated by CsPT4. CBGA transformation to cannabinoid acids THCA and CBDA is mediated by cannabinoid synthases THCAS and CBDAS. Heat exposure decarboxylates THCA and CBDA to THC and CBD, respectively [18].

Fig. 1 Cannabinoids biosynthetic pathway.

Biosynthesis of a cannabinoid mainly occurs in female flower glandular trichomes [19]. Low-density glandular trichomes are observed in male flowers in which trichomes are in a row on the inner surfaces of anthers [20]. Low concentration levels of active constituents in medicinal plants such as cannabis result in a major challenge since the syntheses of metabolites are usually complicated and costly [21]. There are several strategies to increase the concentrations of secondary metabolites, such as manipulation of biosynthesis pathways by genetic engineering approaches, stimulation of secondary metabolite production by various biotic and abiotic elicitors as well as integrated methods.

The application of elicitors, including jasmonic acid, AA, phenylalanine, nitric oxide, and chitosan, is a safe and inexpensive approach that has been used to accumulate different secondary metabolites [22] [23]. Specifically, the application of jasmonic acid increases production of triterpenic saponins, leading to decreases in sterols [24]. In addition, the application of elicitors such as salicylic acid can alleviate toxicity in plants [25]. AA plays major roles in different plants’ molecular and biological processes, such as protein synthesis [26], production of defense compounds [27], senescence [27], ozone tolerance [28], ROS detoxification [26], cellular growth and division, electron donation, cellular H₂O₂ regulation, and phenolic compounds annihilation [23]. Understanding the molecular basis of the elicitors’ effects in the molecular and metabolic levels is a crucial step for improving the production of the metabolites. To this effect, this study analyzes the key gene expression changes of the cannabinoids pathway and quantifies metabolite fluctuations following the application of AA.

Results and Discussion

Cannabinoids are unique plants with polyketide biosynthesized from hexanoate or hexanoate-CoA precursors. Fatty acyl-CoAs are considered polyketide primers in many microbes and plants. However, only a few examples of hexanoate/hexanoyl-CoA originating from polyketides exist in fungi and plants [29]. A promising substitute is the application of exogenic derivers to produce scaleable amounts of cannabinoids [30]. Therefore, the identification of key gene functions is a crucial step to improve cannabinoid biosynthesis by application of elicitors. In this study, cannabis plants were sprayed with 0–1 mM AA. For commercial purposes, the best time to spray AA on cannabis is before flowering time. Here, experiments were performed on four main gene expressions, and active ingredients in cannabis were measured.

[Fig. 2] shows the effects of AA on the expression of four selected genes. [Fig. 2a] shows that treatment with 0.3 and 0.5 mM AA increases PT expression approximately 232 and 115 times, respectively, more than the control group. The highest level of PT expression occured after the 1 mM AA treatment ([Fig. 2a]). Similarly, [Fig. 2b] shows the increased expression of THCAS to be ten and five times that of the control group after treatment with 0.3 and 0.5 mM AA, respectively. At the 1 mM AA treatment, the expression of THCAS increased 37 times more than the control group ([Fig. 2b]).

Fig. 2 Expression changes of THCAS, CBDAS, OLS, and PT following the treatments with different concentrations of ascorbic acid. Values represented the means of 3 replications ± standard deviation.

[Fig. 2c] shows AA significantly increases CBDAS expression at the 0.3 and 1 mM treatments. [Fig. 2d] shows that treatment with 1 mM AA increases the OLS expressions about 20000 times higher than the control group. AA in low concentrations does not have a significant effect on OLS expression ([Fig. 2d]). Similarly, Jalali et al. [31] investigated the target genes’ relative expression, including THCAS, OLS, CBDAS, and PT, in addition to compounds CBD and THC with quantitative analysis using HPLC, which revealed the highest activation of THCAS was 0.1 mM GABA and 1 mM of salicylic acid concentration. They also showed an increase of approximately 90% in the THC level and a decrease in the CBD level 72 h after treatments with 1 mM salicylic acid. The THCAS and CBDAS genes play key roles in the polyketide (OA) pathway, and PT and OLS genes play important roles in the hexanoate pathway.

Oxidocyclase THCAS converts CBGA to THCA, while CBDAS produces CBDA [17] [32]. Increases in the expression of key genes of two pathways indicate that AA simultaneously activates the two pathways for cannabinoids biosynthesis. As shown in [Fig. 2], the OLS and PT expression changes are significantly greater than THCAS and CBDAS gene experessions. To our knowledge, there is not any report that describes the effects of AA on key gene expression processes in cannabinoid flowers. A former study analyzed the whole flower with trichomes and showed readily detectable levels of hexanoyl-CoA and the highest concentrations in the female flowers in comparison to their other tissues, including leaves, roots, and stems [16]. The members of the superfamily of the acyl-activating enzyme forming hexanoyl-CoA caused carboxylic acid activation via the intermediary of an adenylate [33]. Plants contain various substrates, including fatty acids, phenylpropanoids, and jasmonate precursors, to activate carboxylic acids. The enzyme 4-coumarate:CoA ligase (4 CL) engages in the metabolism of phenylpropanoid in addition to the long-chain acyl-CoA synthetases, which are well-identified plant-activated carboxylic acids [34].

The analysis of gene expression along with the metabolic change improves our understanding of elicitors’ underlying mechanisms. This study quantifies the metabolic changes of CBD and THC following AA treatment. [Fig. 3a], b shows THC levels at 48 and 72 h, respectively. At 48 h, THC content levels are in the range of 0.53–0.6 mg.g^-1 d.w. or all AA treatment concentrations. As the time increases to 72 h, the THC metabolite concentration increases by 91.3% with respect to no treatment. The maximum THC content is 0.88 mg.g^-1 d.w. and occurs at the 0.5 mM AA treatment. [Fig. 4a], b shows CBD levels at 48 and 72 h, respectively. At 48 h, CBD levels are between 0.08 and 0.14 mg.g^-1 d.w. for all AA treatment concentrations. At 72 h, the CBD concentration increases by 34.7% for the 0.5 mM AA treatment. In general, the maximum level of THC and CBD occurs at the 0.5 mM AA treatment ([Figs. 3] and [4]). Furthermore, the THC and CBD levels at the 1 mM AA treatment are lower than the 0.5 mM treatment. It is expected that the THC and CBD levels increase for the 1 mM AA treatment over longer time frames.

Fig. 3 Effect of ascorbic acid on THC metabolites following the treatments with different concentrations of ascorbic acid in cannabis plants at 48 hours (a) and 72 hours (b).

Fig. 4 Effect of ascorbic acid on CBD metabolites following the treatments with different concentrations of ascorbic acid in cannabis plants at 48 hours (a) and 72 hours (b).

The trends observed here are in agreement with the literature. Secondary metabolite biosynthesis induction by elicitors has been reported in Arachis hypogaea, Vitis vinifera, and Papaver somniferum [35] [36] [37]. The accumulation of the secondary metabolites, primarily flavonoids, phenolic compounds, hydroxycinnamate esters, and anthocyanins, have been shown in the plant cells. As a result of the accumulation of these secondary metabolites, the penetration of UV-B radiation into deeper cell layers and ROS detoxication decrease [38] [39]. ROSs rise due to UV-B, jasmonic acid, and salicylic acid, which can affect the secondary metabolite biosynthesis. Therefore, one may also expect that UV radiation induces secondary metabolite biosynthesis in cannabis. Increased irradiance leads to an elevated total THC concentration in the plants [40] along with an increased photosynthetic rate and water use efficiency [41]. Specifically, it has been reported that the amount of THC and CBD dramatically increased in cannabis leaves following treatment with 100 mM GA3 [42].

Existing data reveals that abiotic and biotic derivatives may elevate vitamin C concentrations in the plant tissues. One study shows that vitamin C level increases in lettuce due to jasmonic acid treatment [43]. On the other hand, chitosan and salicylic acid are known to be associated with indirect vitamin C stimulation in broccoli through carbohydrate formation, including glucose and sucrose, which are vital players in the l-ascorbate biosynthetic pathway [44]. Increased CBD and THC levels confirm the expression changes of cannabinoid biosynthetic genes after AA treatment. These findings suggest that after AA treatment, the majority of THC and CBD metabolites are produced from the hexanoyl-CoA pathway.

Overall, the findings demonstrate that AA increases THC, CBD, and secondary metabolite production. Also, the results highlight the efficiency of AA as an elicitor for the scalable increase of cannabinoid production from C. sativa L. as a natural source for products with pharmaceutical applications.

Materials and Methods

Plant material and ascorbic acid treatment

C. sativa L. seeds with accession number 891385 were obtained from the CGN seed bank located in the Netherlands. After sterilization using sodium hypochlorite 1.5% solution for 3 min, seeds were transferred to a mixture of soil, peat, and perlite (2:1:1) containing pots. The female plants of cannabis were selected for AA treatment. A total number of 500 seeds was sown and 80% of these seeds were germinated. Among the germinated plants, 30% were female plants. To prevent the reduction of metabolite concentrations following the pollination, male plants were removed immediately after the appearance of early flowers. Immediately before flowering, plants were treated by spraying with 0.3, 0.5, and 1 mM AA. Moreover, some seedlings were treated with distilled water as a control group. Seventy-two hours later, flower samples were taken, immediately frozen in liquid nitrogen, and kept at a temperature of −80ºC.

RNA extraction and cDNA synthesis

RNAs were extracted using frozen female flower samples using bioZOL-G RNA Isolation Reagent (Biofluxbioer) following the instructions provided by the manufacturer. RNA quantity and quality were analyzed using agarose gel electrophoresis and NanoDrop spectrophotometry ND1000. DNase I was applied to remove genomic DNA contamination (Fermentase) following the instructions provided by the manufacturer. cDNA was produced using a iScript cDNA synthesis kit manufactured by Bio-Rad.

Gene expression analysis by real-time quantitative PCR

RT-qPCR on a Light Cycler 96 system (Roche Co.) was conducted using a HiFi SYBR Green Master Mix (5×). The 20 μL RT-qPCR reaction was comprised of 4 μL SYBR R PremixEx TaqTM (2×), 0.5 μL of each forward and reverse primer (10 Pmol/mL), and 4 µL of 1:5 diluted cDNA. The cycling parameters used were 15 min at 95ºC as initial activation, 45 cycles of 15 sec at 95ºC, 20 sec at 60ºC, and 20 sec at 72ºC. The 2^-∆∆CT method was performed to analyze the expression data [45]. Three biological replicates were used as a data source and are presented as mean values±standard deviation. To assess the significance level, Student’s t-tests were used. P values lower than 0.05 were used as a baseline of significance. Gene expression levels were normalized to rbcl as housekeeping genes. Based on the available sequences in NCBI, specific primers for the candidate genes, including the CBDAS, THCAS, PT, OLS, and rbcl, were developed using Plus Primer 3 software ([Table 1]). Subsequently, the physical parameters of the primers were confirmed by Oligo Calculator software.

Table 1 Sequences of the primer genes used to analyze qPCR gene expression.

Primers	Amplicon length	Forward primer (5’→3’)	TM (°C)	Reverse primer (5’→3’)	TM (°C)	Accession Number
THCAS	148	GATCAGCTGGGAAGAAGACG	60.5	ATACCACCGTAAGGGTACAACA	60.1	AB057805
CBDAS	188	CAATTCCAGAATCTGTATTTGTCC	60.3	TTCTTGCTTCTCCCAACTACATA	59.2	AB292682
OLS	145	TTCTTGCTTCTCCCAACTACATA	59.2	ACGCACGACCACTCTTTCG	59.5	AB164375.1
PT	150	CTCGTAAAATCTTCTGCCTGCT	60.1	TTCTTGCTTCTCCCAACTACATA	59.2	AB164375.1
rbcl	106	CTACTGGTACATGGACAACTG	59.5	AATTGATTTTCTTCTCCAGCAACG	60.3	AJ402933

TM: primer melting temperature

Analysis of cannabidiol and tetrahydrocannabinol

Female plants (0.1 mg) were extracted and mixed with 2 mL methanol/chloroform (V/V: 9/1) by centrifugation at a speed of 10000 rpm and a temperature of 10°C for 15 min followed by ultrasonication at a temperature of 50ºC for 40 min. The upper phase was separated and filtered. Subsequently, the solution was dried, and the residue was dissolved in 1 mL of methanol and centrifuged at a speed of 13000 rpm for 10 min. The solutions were subjected to reversed-phase HPLC analyses. The standard solutions of CBD and THC (0.1 mg/mL) were supplied from Carillion Corporation, and the standards were derived based on the areas under the curves measured with HPLC (Agilent 1260 UV/Vis detector) at concentrations of 12.5, 25, and 50 µg/mL. The HPLC device was equipped with C18 LC columns. Plant solutions with concentrations of 12.5, 25, and 50 µg/mL were used to derive the standard curves of the THC and CBD. Twenty microliters of the solutions were injected into the HPLC instrument. Considering the standard samples’ retention time, CBD and THC peaks were observed at the time of 13.6 and 28.7, respectively.

Conflict of Interest

The authors declare that they have no conflict of interest.

Acknowledgments

The authors give their sincere thanks to Dr. Alireza Salami at the University of Tehran for fruitful discussions on this topic.

• References

• 1 Ainsworth C. Boys and girls come out to play: the molecular biology of dioecious plants. Ann Bot 2000; 86: 211-221
• 2 Russo EB, Jiang HE, Li X, Sutton A, Carboni A, Del Bianco F, Mandolino G, Potter DJ, Zhao YX, Bera S, Zhang YB. Phytochemical and genetic analyses of ancient cannabis from Central Asia. J Exp Bot 2008; 59: 4171-4182
• 3 Small E. The Role of Agriculture in Supplying Nutritional, Medicinal, and Recreational Cannabis Products. Planta Medica International Open 2018; 5: S3-S4
• 4 ElSohly MA, Slade D. Chemical constituents of marijuana: the complex mixture of natural cannabinoids. Life Sci 2005; 78: 539-548
• 5 Clark PA, Capuzzi K, Fick C. Medical marijuana: medical necessity versus political agenda. Med Sci Monit 2011; 17: RA249
• 6 Chandra S, Lata H, Khan IA, ElSohly MA. Temperature response of photosynthesis in different drug and fiber varieties of Cannabis sativa L. Physiol Mol Biol Plants 2011; 17: 297-303
• 7 Gaoni Y, Mechoulam R. Isolation, structure, and partial synthesis of an active constituent of hashish. J Am Chem Soc 1964; 86: 1646-1647
• 8 Watson SJ, Benson JA, Joy JE. Marijuana and medicine: assessing the science base: a summary of the 1999 Institute of Medicine report. Arch Gen Psychiatry 2000; 57: 547-552
• 9 Moldzio R, Unterberger A, Krewenka C, Kranner B, Radad K. Neuroprotective Effects of Delta-9-Tetrahydrocannabinol against FeSO4-and H2O2-Induced Cell Damage on Dopaminergic Neurons in Primary Mesencephalic Cell Culture. Planta Medica International Open 2021; 8: e88-e95
• 10 Fellermeier M, Eisenreich W, Bacher A, Zenk MH. Biosynthesis of cannabinoids: incorporation experiments with 13C-labeled glucoses. Eur J Biochem 2001; 268: 1596-1604
• 11 Raharjo TJ, Verpoorte R. Methods for the analysis of cannabinoids in biological materials: a review. Phytochem Anal 2004; 15: 79-94
• 12 Shoyama Y, Hirano H, Nishioka I. Biosynthesis of propyl cannabinoid acid and its biosynthetic relationship with pentyl and methyl cannabinoid acids. Phytochemistry 1984; 23: 1909-1912
• 13 Taura F, Morimoto S, Shoyama Y. Purification and characterization of cannabidiolic-acid synthase from Cannabis sativa L.: biochemical analysis of a novel enzyme that catalyzes the oxidocyclization of cannabigerolic acid to cannabidiolic acid. J Biol Chem 1996; 271: 17411-17416
• 14 Morimoto S, Komatsu K, Taura F, Shoyama Y. Purification and characterization of cannabichromenic acid synthase from Cannabis sativa . Phytochemistry 1998; 49: 1525-1529
• 15 Fischedick JT, Glas R, Hazekamp A, Verpoorte R. A qualitative and quantitative HPTLC densitometry method for the analysis of cannabinoids in Cannabis sativa L. Phytochem Anal 2009; 20: 421-426
• 16 Stout JM, Boubakir Z, Ambrose SJ, Purves RW, Page JE. The hexanoyl-CoA precursor for cannabinoid biosynthesis is formed by an acyl-activating enzyme in Cannabis sativa trichomes. Plant J 2012; 71: 353-365
• 17 Taura F, Tanaka S, Taguchi C, Fukamizu T, Tanaka H, Shoyama Y, Morimoto S. Characterization of olivetol synthase, a polyketide synthase putatively involved in cannabinoid biosynthetic pathway. FEBS lett 2009; 583: 2061-2066
• 18 Luo X, Reiter MA, d’Espaux L, Wong J, Denby CM, Lechner A, Zhang Y, Grzybowski AT, Harth S, Lin W, Lee H. Complete biosynthesis of cannabinoids and their unnatural analogues in yeast. Nature 2019; 567: 123-126
• 19 Lanyon VS, Turner JC, Mahlberg PG. Quantitative analysis of cannabinoids in the secretory product from capitate-stalked glands of Cannabis sativa L.(Cannabaceae). Bot Gaz 1981; 142: 316-319
• 20 Dayanandan P, Kaufman PB. Trichomes of Cannabis sativa L.(Cannabaceae). Am J Bot 1976; 63: 578-591
• 21 Petrovska BB. Historical review of medicinal plants’ usage. Pharmacogn Rev 2012; 6: 1-5
• 22 Govindaraju S, Arulselvi PI. Effect of cytokinin combined elicitors (l-phenylalanine, salicylic acid and chitosan) on in vitro propagation, secondary metabolites and molecular characterization of medicinal herb– Coleus aromaticus Benth (L). J Saudi Soc Agric Sci 2018; 17: 435-544
• 23 O’Brien ER, Read E, Deyholos M, Nelson L. Effects of Nitric oxide Producing Bacteria Azospirillum brasilense on Microbial Composition and Secondary Metabolite Profile of Cannabis. Planta Medica International Open 2018; 5 CAN06P
• 24 Alsoufi AS, Pączkowski C, Szakiel A, Długosz M. Effect of jasmonic acid and chitosan on triterpenoid production in Calendula officinalis hairy root cultures. Phytochem Lett 2019; 31: 5-11
• 25 Shi GR, Cai QS, Liu QQ, Wu L. Salicylic acid-mediated alleviation of cadmium toxicity in hemp plants in relation to cadmium uptake, photosynthesis, and antioxidant enzymes. Acta Physiol Plant 2009; 31: 969-977
• 26 Arrigoni O, De Tullio MC. The role of ascorbic acid in cell metabolism: between gene-directed functions and unpredictable chemical reactions. J Plant Physiol 2000; 157: 481-488
• 27 Conklin PL. Recent advances in the role and biosynthesis of ascorbic acid in plants. Plant Cell Environ 2001; 24: 383-394
• 28 Burkey KO, Eason G. Ozone tolerance in snap bean is associated with elevated ascorbic acid in the leaf apoplast. Physiol Plant 2002; 114: 387-394
• 29 Cook D, Rimando AM, Clemente TE, Schröder J, Dayan FE, Nanayakkara ND, Pan Z, Noonan BP, Fishbein M, Abe I, Duke SO. Alkylresorcinol synthases expressed in Sorghum bicolor root hairs play an essential role in the biosynthesis of the allelopathic benzoquinone sorgoleone. Plant Cell 2010; 22: 867-887
• 30 Gagne SJ, Stout JM, Liu E, Boubakir Z, Clark SM, Page JE. Identification of olivetolic acid cyclase from Cannabis sativa reveals a unique catalytic route to plant polyketides. PNAS 2012; 109: 12811-12816
• 31 Jalali S, Salami SA, Sharifi M, Sohrabi S. Signaling compounds elicit expression of key genes in cannabinoid pathway and related metabolites in cannabis. Ind Crops Prod 2019; 133: 105-110
• 32 Schachtsiek J, Warzecha H, Kayser O, Stehle F. Current perspectives on biotechnological cannabinoid production in plants. Planta Med 2018; 84: 214-220
• 33 Schmelz S, Naismith JH. Adenylate-forming enzymes. Curr Opin Struct Biol 2009; 19: 666-671
• 34 Hu Y, Gai Y, Yin L, Wang X, Feng C, Feng L, Li D, Jiang XN, Wang DC. Crystal structures of a Populus tomentosa 4-coumarate:CoA ligase shed light on its enzymatic mechanisms. Plant Cell 2010; 22: 3093-3104
• 35 Facchini PJ, Johnson AG, Poupart J, De Luca V. Uncoupled defense gene expression and antimicrobial alkaloid accumulation in elicited opium poppy cell cultures. Plant Physiol 1996; 111: 687-697
• 36 Melchior F, Hohmann F, Schwer B, Kindl H. Induction of stilbene synthase by Botrytis cinerea in cultured grapevine cells. Planta 1991; 183: 307-314
• 37 Rolfs CH, Fritzemeier KH, Kindl H. Cultured cells of Arachis hypogaea susceptible to induction of stilbene synthase (resveratrol-forming). Plant Cell Rep 1981; 1: 83-85
• 38 Kakani VG, Reddy KR, Zhao D, Mohammed AR. Effects of ultraviolet-B radiation on cotton (Gossypium hirsutum L.) morphology and anatomy. Ann Bot 2003; 91: 817-826
• 39 Caldwell MM, Bornman JF, Ballaré CL, Flint SD, Kulandaivelu G. Terrestrial ecosystems, increased solar ultraviolet radiation, and interactions with other climate change factors. Photochem Photobiol Sci 2007; 6: 252-266
• 40 Potter DJ, Duncombe P. The effect of electrical lighting power and irradiance on indoor-grown cannabis potency and yield. J Forensic Sci 2012; 57: 618-622
• 41 Chandra S, Lata H, Khan IA, Elsohly MA. Photosynthetic response of Cannabis sativa L. to variations in photosynthetic photon flux densities, temperature and CO₂ conditions. Physiol Mol Biol Plants 2008; 14: 299-306
• 42 Mansouri H, Asrar Z, Amarowicz R. The response of terpenoids to exogenous gibberellic acid in Cannabis sativa L. at vegetative stage. Acta Physiol Plant 2011; 33: 1085-1091
• 43 Złotek U, Świeca M, Jakubczyk A. Effect of abiotic elicitation on main health-promoting compounds, antioxidant activity and commercial quality of butter lettuce (Lactuca sativa L.). Food Chem 2014; 148: 253-260
• 44 Pérez-Balibrea S, Moreno DA, García-Viguera C. Improving the phytochemical composition of broccoli sprouts by elicitation. Food Chem 2011; 129: 35-44
• 45 Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2^-ΔΔCT method. Methods 2001; 25: 402-408

Publication History

Received: 17 October 2021
Received: 06 February 2022

Accepted: 25 March 2022

Article published online:
30 May 2022